Mark Collier briefed me on two updates under embargo at KubeCon Europe 2026 last month: Helion, which opens up GPU kernel ...
Stop letting AI pick your passwords. They follow predictable patterns instead of being truly random, making them easy for ...
At the core of these advancements lies the concept of tokenization — a fundamental process that dictates how user inputs are interpreted, processed and ultimately billed. Understanding tokenization is ...
Background/aims Ocular surface infections remain a major cause of visual loss worldwide, yet diagnosis often relies on slow ...
AI firm Anthropic accidentally leaked its Claude Code source code via an npm package, revealing unreleased features like an ...
Claude, the AI model from Anthropic, was asked to generate a short video, which has since gone viral for its brilliantly ...
Researchers at Bar-Ilan University have discovered that changing just one letter in DNA can completely alter sex development ...
EM, biochemical, and cell-based assays to examine how Gβγ interacts with and potentiates PLCβ3. The authors present evidence for multiple Gβγ interaction surfaces and argue that Gβγ primarily enhances ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Every conversation you have with an AI — every decision, every debugging session, every architecture debate — disappears when the session ends. Six months of work, gone. You start over every time.
Some results have been hidden because they may be inaccessible to you
Show inaccessible results